AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, untagged

Cat: HG10639-M-N

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All AADAC/arylacetamide deacetylase Reagents

CRO Services


All AADAC/arylacetamide deacetylase Reagents

AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1200 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human arylacetamide deacetylase (esterase) DNA.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

AADAC/arylacetamide deacetylase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, untagged Alternative Names

CES5A1 cDNA ORF Clone, Human;DAC cDNA ORF Clone, Human

AADAC/arylacetamide deacetylase Background Information

Full Name
arylacetamide deacetylase

AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AADAC/arylacetamide deacetylase cDNA ORF Clone in Cloning Vector, Mouse MG50243-M
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, untagged MG50243-UT
AADAC/arylacetamide deacetylase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50243-ACGLN
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50243-ACG
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50243-ACR
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50243-CF
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50243-NF
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, C-His tag MG50243-CH
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, N-His tag MG50243-NH
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, C-HA tag MG50243-CY
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, N-HA tag MG50243-NY
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, C-Myc tag MG50243-CM
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, N-Myc tag MG50243-NM
AADAC/arylacetamide deacetylase qPCR Primer Pairs, Mouse MP200269

AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AADAC/arylacetamide deacetylase cDNA ORF Clone in Cloning Vector, Human HG10639-M
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, untagged HG10639-UT
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-GFPSpark® tag HG10639-ACG
AADAC/arylacetamide deacetylase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10639-ACGLN
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-OFPSpark® tag HG10639-ACR
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10639-CF
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10639-M-F
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10639-NF
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-His tag HG10639-CH
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, N-His tag HG10639-NH
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-HA tag HG10639-CY
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, N-HA tag HG10639-NY
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-Myc tag HG10639-CM
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, N-Myc tag HG10639-NM
AADAC/arylacetamide deacetylase qPCR Primer Pairs, Human HP100612
info info
添加购物车成功! 添加购物车失败!