After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human 4E-BP1/EIF4EBP1 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human 4E-BP1/EIF4EBP1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human 4E-BP1/EIF4EBP1 Gene Plasmid Map
Human 4EBP1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

The translational suppressor eIF4E binding protein-1, 4E-BP1 functions as a key regulator in cellular growth, differentiation, apoptosis and survival. The Eif4ebp1 gene, encoding 4E-BP1, is a direct target of a transcription factor activating transcription factor-4 (ATF4), a master regulator of gene expression in stress responses. 4E-BP1 is characterized by its capacity to bind specifically to eIF4E and inhibit its interaction with eIF4G. Phosphorylation of 4E-BP1 regulates eIF4E availability, and therefore, cap-dependent translation, in cell stress. Binding of eIF4E to eIF4G is inhibited in a competitive manner by 4E-BP1. Phosphorylation of 4E-BP1 decreases the affinity of this protein for eIF4E, thus favouring the binding of eIF4G and enhancing translation. 4E-BP1 is important for beta-cell survival under endoplasmic reticulum (ER) stress. 4E-BP1 mediates the regulation of protein translation by hormones, growth factors and other stimuli that signal through the MAP kinase and mTORC1 pathways. Recently, 4E-BP1 was found to be a key factor, which converges several oncogenic signals, phosphorylates the molecules, and drives the downstream proliferative signals. Recent studies showed that high expression of phosphorylated 4E-BP-1 (p-4E-BP1) is associated with poor prognosis, tumor progression, or nodal metastasis in different human cancers.

  • Azar R, et al. (2008) Phosphatidylinositol 3-kinase-dependent transcriptional silencing of the translational repressor 4E-BP1. Cell Mol Life Sci. 65(19): 3110-7.
  • Tominaga R, et al. (2010) The JNK pathway modulates expression and phosphorylation of 4E-BP1 in MIN6 pancreatic beta-cells under oxidative stress conditions. Cell Biochem Funct. 28(5): 387-93.
  • Ayuso MI, et al. (2010) New hierarchical phosphorylation pathway of the translational repressor eIF4E-binding protein 1 (4E-BP1) in ischemia-reperfusion stress. J Biol Chem. 285(45): 34355-63.
  • Contact Us
    • Human 4EBP1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.