14‑3‑3 / YWHAQ Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag

Price:
Size:
Number:

14‑3‑3 / YWHAQ Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
738 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101866542.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

14‑3‑3 / YWHAQ Background Information

The recently identified 14-3-3 tau, whose corresponding gene name is YWHAQ, is in a hypoxia-treated human trophoblast cell line. YWHAQ may play a role in epigenetic regulation of placental genes in the onset of Preeclampsia (PE). Moreover, there was a closer relationship between blood pressure and methylation levels of the YWHAQ promoter.
Full Name
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta
References
  • Cheng Y, et al. (2010) Effect of 14-3-3 tau protein on differentiation in BeWo choriocarcinoma cells. Placenta. 31(1): 60-6.
  • Umahara T, et al. (2010) 14-3-3 proteins and spinocerebellar ataxia type 1: from molecular interaction to human neuropathology. Cerebellum. 9(2): 183-9.
  • Wang B, et al. (2004) A role for 14-3-3 tau in E2F1 stabilization and DNA damage-induced apoptosis. J Biol Chem. 279(52): 54140-52.

14‑3‑3 / YWHAQ cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait